Can I read Cloning Activity Group Report on EtoBox?

Cloning Activity Group Report by hanoufrabie is a document available to read on EtoBox.

What is Cloning Activity Group Report about?

The document lists group members involved in a cloning activity, including Hanouf Rabie Ali Abbas, Leena Ibrahim Abdelrahim, Sarya Mudduthir Abdelrahim, and Mariam Abdelgadir Ahmed. It provides forward and reverse primer sequences for the cloning process. The forward prime is TAATAAGCTTCAACATGAGTACAGTTC and the reverse prime is ACCAATATGTGGTTTTGGTGTCTAGAATAG.

Author

hanoufrabie

Language

EN